Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST193594
Clone ID OST193594
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST193594
Sequence
ACTGAGCTTAGCTATTGAGAAGATGGTGGNCCACTTGGCAAACACGGAGATCAACAGCCAGCGGATTGCAGCAGTGGAGA
GCTGTTTTGGGGCATCGGGGCAACCGCTGGCCCTGCCTGGCCGTGTGCTCCTAGGCGAGGGGGTACTGACCAAGGAGTGC
CGCAAGAAGGCCAAGCCACGCATCTTCTTTCTTTTCAACGACATCCTGGTGTATGGCAGTATTGTGCTTAGCAAGCGCAA
GTACCGCAGCCAGCATATTATTCCCCTAGAAGAGGTAACATTGGAGCCACTGCCTGAGACCCTGCAGGCCAAGAACCGAT
GGATGATCAAGACAGCCAAGAAGTCCTTTGTGGTGTCGGCAGCCTCCACCACGGAGCGCCAGGAATGGATAAGCCACATC
GAAGAGTGTGTGCGGAGGCAGCTACTGGCCACAGGCCGCCAGCCCACCACGGAGCACGCAGCTCCCTGGATCCCGGACAA
GGCCACGGACATTTGCATGCGCTGCACGCAGACGCGCTTCTCCGCACTCACCCGGCGTCACCACTCCTGTGT
Sequence Type mRNA
Unitrap ID UNI25157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 39006639..39007179 535
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074170 (Plekhf1) NM_024413 pleckstrin homology domain containing, family F (with FYVE domain) member 1 Gene [Source:MGI Symbol;Acc:MGI:1919537]

 
Come back to gene ENSMUSG00000074170


For any suggestions or comments, please send an email to unitrap@crg.es