Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSE042
Clone ID CSE042
Vector pGT0Lxf
Project baygenomics

Sequence tag CSE042
Sequence
TCAATTCCGAGGCGGGAGCATGAAGTTGATTGACCATGATCTCTCCGTCCTTTAGGAAAGGTATGCTGAAGGAGAGGGTC
ATGGACTTGGCCTCCCAGACGACCATCCTGCCCCTGCTGTTTGGCTGCCTGGGGATTTTCAGCCTCTTCAGGCTGCTGCA
GAGGATCCGCTCAAAGGCTTACCTGAGGAATGCTGTGGTGGTAGTCACGGGCGCCACCTCAGGTCTCGGCAG
Sequence Type mRNA
Unitrap ID UNI6534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60644179..60657843 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es