Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSE044
Clone ID CSE044
Vector pGT0Lxf
Project baygenomics

Sequence tag CSE044
Sequence
CAAACACACACACATTTTTCCCCGGACTTGGAAAGTCACCCAAAGCCGCCCCAAGTGCAGGCACACAGACCTTGCTGACG
GAAGGCAGACCCTCTCCATCTCACCTGCCCTCCAACTGCCTGAGCTACCCAGTCCTCCTTTTCCGGGGGACCATGCAGCT
CCCCGGTGGTGTGCATTGGAATGGACTTCGGACCTTGGACTCTTGGGATGCAAAGGATGAAGTGACCCCCACCCCCAACT
GTGTTTGAGGAATCTCTAGGACCCCGTGAGAGTTTGGGACCAAGGAGCGGAGAATGGATCTTGGAACAGCTGAAAGCACC
CGGTGCACCGACCCACTTGCAGGCAAGCCTCTCAATGTGC
Sequence Type mRNA
Unitrap ID UNI6535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148178564..148303152 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es