Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST193094
Clone ID OST193094
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST193094
Sequence
GACTGAGGGGACAGACACCGGAAGGGNCCCCCCAGTCACCCGTGTTTGAAGGTGTCTATAACAATTCCAGGATGCTGCAT
TTCCTGACAGCTGTAGTGGGTTCTACTTGTGACGTAAAGGTGAAAAATGGCACCACTTACGAGGGCATTTTCAAGACTCT
GATTTCTGCCCTGAACGTGCACCCAGGCGCCAACAAAAAGACAAATTCTTGACTGAGTGAGAAAGTAGAACCCAGGACTT
GTAAAAGGGATGGCAAGCACAGCCAATTGCTCTGTAACATAAACTAGTACTCTGCCCCAAGCTTGGGTGTATTCTGGGGC
CAGCCTTTCCACCTTAAGCTTACACCCACACTATTGAAAACACTAATGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77993769..77993983 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019437 (Tlcd1) NM_026708 TLC domain containing 1 Gene [Source:MGI (curated);Acc:Tlcd1-001]

 
Come back to gene ENSMUSG00000019437


For any suggestions or comments, please send an email to unitrap@crg.es