Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST193046
Clone ID OST193046
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST193046
Sequence
CATAACGTTCTTGTGNAACTCTGAAGCCAAGGGCAGCCCTATCGCTTNNATTGNTNNAGNAACAGAAGCTGTGTCTGCAA
GCCCGGCTTCAGCNTCGGAGAAGGAATTGATCACTAACCCTGCAGAGAGCTGTGAAGACATCAACGAGTGTTTACTACCT
GGATTTTCCTGTGGAGACTTTGCCATGTGTAAGAACTCAGAGGGGAGTTATACCTGCGTCTGTAACCTGGGATATAAGCT
CCTTTCTGGTGCAGAATCTTTTGTTAACGAGAGNGAGAATACATGTCAAG
Sequence Type mRNA
Unitrap ID UNI25172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86257313..86258019 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es