Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192850
Clone ID OST192850
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192850
Sequence
ACTGAGGTCGTGGTGGGTCAANATTAGTAGAAATCCAANATACAACGAACACTAGGATACAGGTNATAAAANGAAATCCT
GAGGCAGAAATCAAAATTTTTGGTNGTACAGCCATGCANACANAAGCAAAAACAGTGATACGATANTGTNGTTANANAAC
AACAATAATTACATTCCAGGACAAAGAGTTGGTATTATTGCATTCCAACCTACCGTTGNAGCAGATACCAGCACAAGTGA
GAGTGTAACAGACGATCAGCCATTGATAGATTGGGATCAAATTCGAGAAGATGCTTTGAAATGGGAAAAGAAAAAGTGGG
CAGGAAAGAAAATTTTAATATAACATGTGATGACTTGAAAGATGGTGAGAAGCGTCCTTATCCCCAACCCTATATGTAAA
TTTGAAGATGCCTTTCAAAGTTACCCAGAAGTAATGGAAAACATTAAAAGAGCAGGCTTTCAAAAACCTACACCGATTCA
GTCACAGGCATGGCCAATAGTTCTACAAGGAATAGATCTTATTGGAGTAGCACAAACTGGAACAGGGAAGACACTTAAAA
Sequence Type mRNA
Unitrap ID UNI25176

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78246846..78260073 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070291 (RP23-366K1.1)  

 
Come back to gene ENSMUSG00000070291


For any suggestions or comments, please send an email to unitrap@crg.es