Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB052
Clone ID YHB052
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB052
Sequence
GAATTCGACTCCGAAGACTTCTCCACATCGGACGAGGATGAGGAATACTTGCCGTCC
Sequence Type mRNA
Unitrap ID UNI6542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114378045..114378101 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es