Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192696
Clone ID OST192696
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192696
Sequence
GACTGAGGGGATATACGGAACCTCCTTGTCTGGATCAAGAAGAATTTGCTAAAAGAGCGACCAGAGCTGTTCATCCAGGG
AGACAGTGTGCGGCCAGGAATCCTGGTGCTGATTAATGATGCCGACTGGGAACTGCTGGGGGAGCTGGACTACCAGCTGC
ANGACCAAGACAGCATCCNTCTTCATCTNCACACNTGCACGGCGGCTGAGGCCTCCCCAGTGGGCCCAAGCACCTTTGCA
GGGGAACACAGGACAACCACAGCACTCCTCGATCTGCTTNCAGGTCCTCAGTCCCCCTTGNCTGCCTCCTTCCCTGCTGT
ACCCCTGAGCTTCCTCTAGGCAGGGAAAANAGGCCAGGNGCTAAAAATGAGCCTTTCTGGGCAAGGCACGTGAGCAGGGA
GAGCGAAGAGAGAGAGCAGCNGCCTGAGTCCAGCACTCCTCCCAGCAGCTGAGGTGGGGGNAGGGGTGGTTCCTTGTGCT
GTGTNAGGAGTAAAAGGGGGGGCTTCTGTGCCCAGGNGACCCANCTGCTTGCCACTCATGTG
Sequence Type mRNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29696920..29699016 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es