Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192570
Clone ID OST192570
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192570
Sequence
GACTGAGTACCGGGGCATTGAATTTAAAGCTTCACAAACATTAGGCAAGTGTTCTACAACTGAGCTACATCCTTGAACAA
AACTAATTACTTTGATATGTTCTATATGGGGAAGTGTCAGTGTAGTCCACTATAGTACTCAAATGTAAATAATGATTGTT
TAACAACCAACCTCTAAGTGTATAAGTGTATAAACAGAATTATAAAATACTG
Sequence Type mRNA
Unitrap ID UNI25184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37274784..37274989 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075376 (Rc3h2) NM_001100591 ring finger and CCCH-type zinc finger domains 2 Gene [Source:MGI (curated);Acc:Rc3h2-001]

 
Come back to gene ENSMUSG00000075376


For any suggestions or comments, please send an email to unitrap@crg.es