Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB076
Clone ID YHB076
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB076
Sequence
GGTGCAGGTCCCGGCCTGCGCCTGCGGAGGGCTCAGGCAGAGGGTCGAAGCGAGCGGCGCTCGCGACAGACTGCGCTCCG
CGATGGTGGGCGTCCCTGGAGCGGCCGCCTTCCAACTTGGTTGTGAGAAAAGGGTGCCAGCAATGCCTGGATCGCCTGTG
GAAGTGAAGATACAGTCAAGATCCTCACCTCCCATCATGCCACCCCTCCCACCAATAAATCCTGGAGGACCGAGGCCAGT
GTCCTTTACTCCTACAGCAT
Sequence Type mRNA
Unitrap ID UNI6550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262257..154326279 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es