Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192529
Clone ID OST192529
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192529
Sequence
GACTGAGCTCATATCCCCATCGTTTGAATCTCTTTTATCTTGCCAATGATGTCATACAGAATTGTAAACGGAAAAATGCA
ATCATATTTCGTGAATCATTTGCTGATGTGCTTCCTGAAGCAGCCTGCTCTAGTGAAGGATCCATCCGTNTCTANGNCTA
TAGAACGAATCTTTAAAATCTGNNAAGATNGAAATGGGNCCCCAGAACACATGCTTGTGGCGTNCGANAGAAGCTANCCA
ACCACNTTTNTNANTNATAGGCAGCTGAAAGAAAATCTGAACAAACAACCGANTNAGCAGNCGGAAGAAATCACAAAGTA
AGGAACAANATCTCAACTAACATAAAATTACCTCCTCCTTTTGGAGCAGAAGAAAATGTAGACCATTTGACATCGTACCT
GNCCTAAACCATGGGCAAGCTTGTGTTTCCCAGGCCTGGGAGGCTCCCAGTGACTTAGACTAATCAAGCCAGCATGAAGN
NTACTTCTTTTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI9428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95590056..95594154 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es