Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192434
Clone ID OST192434
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192434
Sequence
ACTTGCTGCGGAGCCGTAACTCGTCCACCTNTNCTGACGAGCAGCCCCATATTGGCAACTACCTGGCATCCTTAAGACCA
TTGGCAAGGGTAACTTTGCCAAGGTGAAGTTGGCCCGGCACATCCTGACGGGGAAAGAGGTAGCTGTGAAGATCATCGAC
AAGACCCAGCTGAACTCCTCCAGCCTACAGAAACTGTTCCCGAGAAGTAAGAATANTNAANGNACATGAANATGGGCGTC
NGGGTTGAGNCNNNCTGCAAAAAGCCGGATATTGAGCCATATTCTNGGACTTTTGGNCTNGNAGGAATGCCGAGAGAANN
NCAGGNNNAGCTNAANGANCAGGCCTNCGGGGACAAGGCCTTCCAGACGATGGCCACCATGTNTTNGGNACAGNTNATNT
NCGNCCCTTCCNTNCAGGCCAAGCTGGGCCCTTCTGGNCCTNAGGCCACTGAGCTTTT
Sequence Type mRNA
Unitrap ID UNI24312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7361843..7365229 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024969 (Mark2) NM_001080390 MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]

 
Come back to gene ENSMUSG00000024969


For any suggestions or comments, please send an email to unitrap@crg.es