Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0248
Clone ID AY0248
Vector pGT0lxr
Project sanger

Sequence tag AY0248
Sequence
ACAACTTGAAGGAGAATACGAATACGTAACCAACGAGGGCACAGTGTTCACATTCAAGACGAACCGCAATTCTCCCAATT
ATCGGCTGATCAATATCGACTTCACGGACCCTGAAAAGAACAAGTGGAAAGTGCTCGTACCGGAGCACGAGAAGGATGTC
TTAGAATGGGTGGCTTGTGTCAGGTCCAACTTCCTGGTCTTGTGCTACCTCCATGACGTGAAGAACATTCTACAGCTTCA
CGACCTGACGACTGGTGCTCTCCTCAAGACCTTCCCCCTGGATGTGGGCAGCGTGGTGGGCTACAGTGGGCGCAAGAAGG
ACTCTGAGATCTTCTACCAGTTCACATCCTTCCTATCTCCAGGTGTCATTTACCACTGCGATCTTACCAAAGAGGAACTG
GAGCCCATGGTTTTCCGAGAGGTGTCGGAAAGGGAATCGATGCTGCTGATTNCCANACAATCCACCTTTAAAGGGCCG
Sequence Type mRNA
Unitrap ID UNI628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44834896..44845872 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019849 (Prep) NM_011156 prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]

 
Come back to gene ENSMUSG00000019849


For any suggestions or comments, please send an email to unitrap@crg.es