Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST192231
Clone ID OST192231
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST192231
Sequence
GACTGAGCAGGCTTCTGGTCTGTGGCAGGCAAGAGATTCTGCCCCTGAGGCATGGCCGGAAGACAGAACTAGCTGAGTGC
TTCAGTCTGCAGAAGTCTTTCAGGATTCAGCTGAGGTGGGCCTCAGTCGGCAGACAAGATGCTCCTGGCTCTGGGACTCA
CGCCTGGTGCTCTATGCAAGCCTCCAGGCTGAGGAAAACTGTAAGTCCTGGTATTTTCACATGGCTTCCTTCTTTGTGTC
TTTTCTGAAATTAACTCATGTCAGACTGCTTAGGGTTGGTGTTTACAACAACTAAGAAAACTCTCAAAGCCTTGTTCTAA
ATCAAGGTTCAAAGAGTGTGTATTAGAGACAGCGGTGTAGGAGAAAATTGCTGAACACCAGTCTTACATCTTGGNGGGTT
TCTGTTTGTTGGAATGGGAGAGAAGGGGGTTTTTT
Sequence Type mRNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575982..106576500 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es