Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB130
Clone ID YHB130
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB130
Sequence
GGCCCTGGCCCCTCTGTTGCCAAGGCTGAGCTTGCAGAGGTGAGGCGAGAATGGGCCAAGTACATGGAAGTGCATGAAAA
GGCTTCCTTCACCAACAGTGA
Sequence Type mRNA
Unitrap ID UNI6566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110292078..110292178 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]

 
Come back to gene ENSMUSG00000036057


For any suggestions or comments, please send an email to unitrap@crg.es