Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST191759
Clone ID OST191759
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST191759
Sequence
GAAAGCAGGCAGTGTCCTCGGACCCGTAAAGTTTGTGTTACTGAAGGTGGGACACTCAACTCCTGTGCAGACAAGGAGCT
CAACAGGAATGGTATCAGACTTCTCTCTTCAGAATGTGACAGCCAGAGACTCGGGGGAATACAGCTGTGTTTACTATCAG
GCAAAGGCTACTTAA
Sequence Type mRNA
Unitrap ID UNI25205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3497600..3497773 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053338 (CAAA01179078.1.1.20098) NM_177363  

 
Come back to gene ENSMUSG00000053338


For any suggestions or comments, please send an email to unitrap@crg.es