Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST191448
Clone ID OST191448
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST191448
Sequence
GACTGAGAGGACCAGACTAGCATCTCTCAGTGGGTTCCAGTATGCAGCCAACTGGTATCAGTGTCTCCTACCCAAAGACA
GTGGAGCAGCACTTCCCAGTGGCCTCCAGAAGAATCAGTCTCGAGTGTGTTTGGGATCAGAACAGACTGTTGGAGCGGAC
ACAGCGCAGAGTAGGAAATACCACAACACAAGTAAGCTTCTTACGTACCCAAGATTTCCCACAGCCTGTTGAAGAGAAGG
TCGGTCCCTTCACCAAGATAATAGAAGCCATGGGATTCATTGGACCTTTGAAATACAGTAAATGGAAGATCAAGATCGNG
NCCCTCCGCATGTACACAGAGCTGCGTGGAGAAAGNACTTGACTTCGAGGAGTTNTTTNTTGAGGTGTCAGATGCCCGAN
ACATTCAACTCCTGGTTTTCTCATAACCCTGCTTCATGTTCTGGATGTGGCTAAGTCCGAATGGAAGCAGGGAAGGCCCG
GACCTGGGAANGTACATNGTGNCGGNATCATAGTTCATTTNATGTGGGAAAGATGTGGA
Sequence Type mRNA
Unitrap ID UNI5018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155712867..155747465 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es