Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB191
Clone ID YHB191
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB191
Sequence
GCACCGGAACAGTTGCCGGAGAGTTCATCCGCCAGCTTAAGAGATGCCGCCGAAGGGGAAAAGTGGTTCTGGAAAAGGAG
GGAAAGGAGGTGCAGCCTCTGGGAGTGACAGTGCTGACAAGAAGTCTCAGGGTCCTA
Sequence Type mRNA
Unitrap ID UNI6576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 99314818..99317057 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079480 (Pin4) NM_027181 protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) Gene [Source:MGI (curated);Acc:Pin4-001]

 
Come back to gene ENSMUSG00000079480


For any suggestions or comments, please send an email to unitrap@crg.es