Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB207
Clone ID YHB207
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB207
Sequence
GAGATCATCATGGCGTCTCCCAGTGGGAAGGGATCTTGGACGCCCGAGGCTCCTGGTTTTGGGCCGCGGGCGCTAGCACG
GGACCTGGTGGACTCGGTGGACGACGCCGAGGGCCTTTACGTGGCTGTTGAGCGGTGTCCTCTGTGCAACACCACTCGCC
GGCGGTTGACTTGCGCCAAGTGCGTCCAGAGCGGTGATTTCGTCTATTTCGACGGCCGCGACCGGGAGAGGTTTATTGAC
AAGAAGGAAAGACTAAGCCAACTTAAGAACAAGCAAGAAGAATTTCAGAAAGAAGTACTAAAAGCTATGGAAGGA
Sequence Type mRNA
Unitrap ID UNI6580

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48178870..48188089 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037526 (D14Ertd436e) NM_172599 Uncharacterized protein KIAA0831 [Source:UniProtKB/Swiss-Prot;Acc:Q8CDJ3]

 
Come back to gene ENSMUSG00000037526


For any suggestions or comments, please send an email to unitrap@crg.es