Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB232
Clone ID YHB232
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB232
Sequence
GGCCAGCCCTCCTCCCCTCCCTGGAGCTGGGGCACAGCAACATCCCAGCAAGCTCCAACA
Sequence Type mRNA
Unitrap ID UNI6583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117575705..117575764 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es