Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST191074
Clone ID OST191074
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST191074
Sequence
CCTGTTTAAGCTGCTTTTGATTGGTGACTCCGGCGTGGGCAAGTCGTGCCTGCTCCTGCGGTTTGCTGATGACACTTACA
CAGAGAGCTACATCAGCACCATCGGTGTGGATTTCAAGATTCGAACCATTGAGCTGGACGGCAAAACCATCAAACTGCAG
ATTTGGGACACAGCTGGTCAGGAGCNGGTTCAGGACCATCACTTCCAGCTACTATCGCGGGGCTCATGGCATCATTGTGG
TGTATGACGTCACTGACCAGGAGTCCTACGCCAACGTGAAACAGTGGCTGCAGGAGATAGATCGCTACGCCAGTGAGAAT
GTCAATAAACTCCTGGTAGGCAACAAGAGTGACCTCACCACCAAGAAGGTCGTGGACAACACCACGGCCAAGGAATTTGC
AGACTCTCTGGGTGTCCCCTTCCTCGAGACAAGTGCCAAGAATGCCACCAATGTTGAGCAGGCATTCATGACAATGGCTG
CAGAGATCAAAAAGCGGATGGGGCCAGGAGCAGCGTCTGGGGGTG
Sequence Type mRNA
Unitrap ID UNI20803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5100440..5105244 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024870 (Rab1b) NM_029576 RAB1B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1923558]

 
Come back to gene ENSMUSG00000024870


For any suggestions or comments, please send an email to unitrap@crg.es