Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB244
Clone ID YHB244
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB244
Sequence
CCATTACCAGGCTATACACAACCCTCTGGTATAAGTAGTATCCCTCCTCAACCACCATATTATCCATCCAATGGCTATCA
GTCTGGTTACCCTGTTGTTCCCCCTCCTCAGCAGCCAGTTCAGCCTCCCTACGGAGTACCAAGCATAGTGCCACCAGCTG
TTTCATTGGCACCTGGAGTCTTGCCAGCATTACCTACTGGGGTCCCACCTGTGCCAACACAGTATCCGATAACACAAGTG
CAACCTCCAGCCAGCACTGGA
Sequence Type mRNA
Unitrap ID UNI2693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88504180..88504433 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es