Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190801
Clone ID OST190801
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190801
Sequence
GACTGAGGTGATCCGCAGGGGCTGGTTGACCATCAACAATATCAGCTTGATGAAGGGTGGCTCCAAGGAGTACTGGTTCG
TGCTGACAGCTGAGTCATTGTCTTGGTACAAGGATGAGGAGGAGAAAGAAAAGAAGTACATGCTGCCACTGGACAACCTC
AAGATCCGGGACGTGGAAAAGGGCTTCATGTCCAACAAGCACGTGTTTGCCATCTTCAACACAGAGCAGAGGAATGTCTA
CAAGGACCTTCGACAGATTGAACTGGCTTGTGACTCCCANGANGATGTGGACAGCTGGAAGGCTTCGTTCCTGCGCGCTG
GNGTCTACCCAGAGAAGGACCAGGCAGAGAATGAGGATGGAGCACAAGAGAACACCTTCTCCATGGACCCGCAGCTGGAG
CGACAGGTGGAGACCATNCGTAACCTGGTGGACTCCTACGTGGCCATCATCAACAAGTCCATCCGTGACCTTATGCCAAA
GACCATCATGCACCTNATGATCAACAACACAAAGGGCCTTCNTCCACCATGAGCCTGCTGGCTTACCTGTTATTCATCAG
CAGACCAGAGCAGC
Sequence Type mRNA
Unitrap ID UNI25236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21298946..21308936 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es