Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190763
Clone ID OST190763
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190763
Sequence
AACTGAGGTGCCTCCCCTTCTTGGGGACGTGGTCACCATGTTCTCCTGCGCGAAGGCCTATGAGGACCAGAACTACTCGG
CGCTGAAGCGGGCCTGCCTGCGCAAGAAGGTGCTGTTCGAGGATCCCCTCTTCCCTGCCACCGACGACTCCCTTTACTAT
AAGGGCACCCCAGGGCCCACAGTCAGGTGGAAGCNGGCCTAAGGATATCTTGCGACGATCCCCGGCTCTTCGTAGATGGC
ATCAGCTCCCATGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCTGCCTGCTCATCACTGGCCTCCCGAGA
GTCACTCTGGCAGAAGTTTTCAGGAATGGCAGCAGGAAGATCTTGAGTTCAAGGCTTGCTTGACCTACTGATTAAATTCC
ATTTCAATAACAAGGAAAAACA
Sequence Type mRNA
Unitrap ID UNI20585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105297177..105310622 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035547 (Capn5) NM_007602 calpain 5 Gene [Source:MGI (curated);Acc:Capn5-001]

 
Come back to gene ENSMUSG00000035547


For any suggestions or comments, please send an email to unitrap@crg.es