Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190754
Clone ID OST190754
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190754
Sequence
GACTGAGCCTTGGTGAATATTTGGCTGAAGCCATTANACTAATTGCTTGCCATCATGAGCAGAAGCAAACGTGACAACAA
TTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAG
CTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCANTCAAGAAGNTCATACNNNCATTTCAG
AGTNAGACCNATGCTTNTNGNNNCTANCGAGCACTAGNTCTTATGAAGNGGGTTNATCACAAAAATATAATTGGCCTTTT
GAATGTTTTCACACCACAGAAATCCCGTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTT
TGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCT
TCACTCTGCTGGAATTATTCATCGGNACTTAAAGCCCTAATAANATAATAATCAAATCACAC
Sequence Type mRNA
Unitrap ID UNI25238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34215810..34224212 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021936 (Mapk8) NM_016700 mitogen-activated protein kinase 8 Gene [Source:MGI (curated);Acc:Mapk8-001]

 
Come back to gene ENSMUSG00000021936


For any suggestions or comments, please send an email to unitrap@crg.es