Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190728
Clone ID OST190728
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190728
Sequence
GACTGAGATGTCATGGNCAATATTACCAGNCAGAACCAATTCTACGAGACACCAGTCATCAAGCAAGAAAATGAGTCAAG
CTATGATAGGAGACCACTAGACATGGAGCCACAGCAGCAAGTATATCACCCAGAATTGAAGACAGAAATGAAGCAAGAAG
CCCCACCCAGCTTCCTCCCCCCTGAAGCCTCACAGCTCAAGACAGACAGACCACAATTCCAGAATCGAAAGAGGCCCTTT
GAAGAGAATCGAGGCCGTGGGTACTTCGAGCACCGAGAGGATCGAAGGGGCCGCTCTCCTCAGCCTCCTGCTGAAGAGGA
TGAAGATGACTTTGATGATACACTTGTGGCCATTGACACATATAACTGTGACCTGCACTTCAAAGTGGCCCGAGACCGGA
GTAGTGGCTATCCATTGACGATTGAGGGCTTTGCATACCTGTGGTCAGGAGCCCGTGCCAGCTATGGGGGTCAGAAGANG
GCGTGTGTGTTTTGAAATGAANATCAATGAGGAAATCTCCGTGAAGC
Sequence Type mRNA
Unitrap ID UNI20107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26528021..26536011 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es