Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB304
Clone ID YHB304
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB304
Sequence
GGGCGGTGGGCTATTTCGTGCAGCATACCTTAGAGCACATTGAGCGTAAGAAGGAGGAGGTGGGCGTGGAGGTGAAGCTG
CGCTCCGAGGAGAAGCACAGGGATGTCTGCTACTCCATCGGGCTTGTGATGAAGCATAAGAGGTACGGCTACAACTGTGT
GATCTACGGCTGGGACCCTACGTGCATGATGGGGCATGAGTGGATCCGAAACATGAATGTGCACAGCCTGCCTCATGGCC
ACCATCAGCCCTTCTACAACGTCCTGGTGGAGGATGGCTCCTGCAGATATGCAGCCCA
Sequence Type mRNA
Unitrap ID UNI6562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118450396..118452179 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032898 (Fbxo21) NM_145564 F-box protein 21 Gene [Source:MGI Symbol;Acc:MGI:1924223]

 
Come back to gene ENSMUSG00000032898


For any suggestions or comments, please send an email to unitrap@crg.es