Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190357
Clone ID OST190357
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190357
Sequence
GTTTGGACCAGCCGGCCGCGGACGATCTGCGCNCTGGNTCGANGANGTGNGNGGCCTAGGCATTTGGCNCCANTTCCAGC
TGGGGCCTGAAGGACGGCATCATATNNGTGCGANCCTCATANGCCNGCCNNACGCCNCGGCNTCTGTGNAGAGACGTCAA
CGNNNTCCATCANATCNNCTTGGCCCCCAGTCTGGAGANNTNTCGGCAACCNTCNGNTNAAGCCTCTCCAGGGCNNTACG
GTANTGANAGCCCCANTGANTCTNTTTGAAGCAAACGNCCCTCTTTGAGNNNTGGCAACATGACCCCAGGTTCAGACGNC
GCCTGGTGGCTCCTAGCAGGTCTGGCGAAAACAAAAGGATTCCACTACAACCATTGACATTTGGCGTTAAGTATGCAGAA
AAACAAACAAGACGTTTTGATGAAGGCAAATTAAAGGCTGGCCAGAGTGTAATTGGTTTACAGATGGGTACCAACAAATG
TGCCAGCCAGGCGGGCATGACAGCCTATGGGACTCGGAGGCATCTTTATGATCCCAAGATGCAGACGGACAAACCCTT
Sequence Type mRNA
Unitrap ID UNI25248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121152882..121157959 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es