Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB332
Clone ID YHB332
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB332
Sequence
CCCTTTTTGCCTCTTCTGCCGCCATGGCGCCTGTGAAAAAGCTTGTGGCGAAGGGGGGCAAAAAAAAGAAGCAGGTTTTG
AAGTTCACCCTGGACTGCACTCACCCTGTAGAAGATGGAATCATGGACGCTGCCAATTTTGAGCAGTTCCTCCAGGAGAG
AATCAAGGTGAATGGGAAAGCTGGCAACCTCGGCGGAGGAGTCGTGACCATCGAACGCAGCAAGAGCAAGATCACTGTCA
CTTCAGAGGTGCCTTTCTCCAAA
Sequence Type mRNA
Unitrap ID UNI1121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151699970..151704235 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es