Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB333
Clone ID YHB333
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB333
Sequence
AAGAATGTTCCGTTTCGAGTCTTTGGAGGATTGTCCTCTAGATGAAGATGAAGATGCATTTCAAGGCCTGGGAGAAGAAG
ATGAAGAAATTGATCAATTTAATGATGATACCTTTGGGTCAGGTGCAGTT
Sequence Type mRNA
Unitrap ID UNI4995

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11987049..11988948 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046139 (Patl1) NM_172635 protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]

 
Come back to gene ENSMUSG00000046139


For any suggestions or comments, please send an email to unitrap@crg.es