Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST190103
Clone ID OST190103
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST190103
Sequence
ATTTTAGAGGACTACGCTGCCCGTCTGATGCCNNNCGGTCGANAGGTCANAGGGATGCGGANAGAGTGGGTGAGAACGAC
GGNTACATGGAACCGTACGATGCACAACAGATGATNNCAGAATTCANACGCCGNGGTTCCNAAGATCCCCTGGTGAAGGC
CCTCCAGTTGCTTGATGGCCCGAGTGAACCAGGGGAGACTGTGAAGGTGGAGGCCACAGCCAAGAGACGCANCTCCAAGG
ACCTGCTGGGGAAGCCGCTCANAACTCTATGACACCCCGTACGANCCTTCGGAGGGTGGCCAACGTGTGGCATAGGTNAA
GACNCGGCCAGTANACAGCATGCTACCAGAGGAGGATGATCGGCCCGCTGCTGAGTATGAACAGCCCTGGGAGTGGAAGA
GGGAGCAGATCGCGAGAGCCCTGTCAGTCCAGTTTGAGGGATCTGATCGACCTCCGGGCAGAGAGGATGCAGGGAGACCG
CACCACTGGCAGAAGACCTTGAAGCCGACCCTGTCAGACCACGGTGATGGGGAGAAGGTGGACCCAGG
Sequence Type mRNA
Unitrap ID UNI25255

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89638072..89655651 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046280 (She) NM_172530 src homology 2 domain-containing transforming protein E Gene [Source:MGI Symbol;Acc:MGI:1099462]

 
Come back to gene ENSMUSG00000046280


For any suggestions or comments, please send an email to unitrap@crg.es