Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB362
Clone ID YHB362
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB362
Sequence
AAACAGAAACTGGAGAAAAACAGAATAAAAATGTCACCTACGATCTCTCAAAATTGGTAAACTATCCAGGTTTTAATATA
TCTACTCCCAGAGGTATTCCAGATGAATGGAGAATGTTCGGTTCCATACCAACGCAGGCGTGTCAACAGAAG
Sequence Type mRNA
Unitrap ID UNI6603

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124153041..124154635 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029427 (Zcchc8) NP_081770 zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

 
Come back to gene ENSMUSG00000029427


For any suggestions or comments, please send an email to unitrap@crg.es