Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189895
Clone ID OST189895
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189895
Sequence
GACTGAGGTATGGGAGTTTTGCCTGGCTAAGACAGAAGATGGTGGCGGATCCCCCGGAAGTGATGTTACAGACACTTGTG
AGCCTCCATGTGGATGCTGGGAGTTGAATCCGAATTCCCTGGAAGAGGAGCACGTGCTGTTCACCTGCTGATCCGTACCT
GGAGCTCCACAACGATGACACACCGAGTTGTGAGAGTGAAGGTTATAGCCTGGCATAGGCCTGGCCAAGAAAGACATCTT
GGGAGCCAGGTAAATAACAATGCATGAGCTTGGGGTTTAAGGAAACAGTATTGCTTAGTTTCTTTCTTGAACTTTGATTA
AATGAAAATCTGAGTGATAGTAA
Sequence Type mRNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72517758..72519203 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es