Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB379
Clone ID YHB379
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB379
Sequence
GAAGATCAAGGAAGAGCCTGAGAGCGACATCACATTTCCTGTCAGTGAGGAGCTAGAAGCGGACCTTGCTTCTGGAGATC
AGTCCTTACCCATTGGGGTCCTCGGGGCTCAGAGTGAGCGCTTCCCATCCAACCTGGAGGTGGAGGCTTCGCCACAGGCT
CCAA
Sequence Type mRNA
Unitrap ID UNI6606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31820640..31820803 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053134 (Supt7l) NM_028150 suppressor of Ty 7 (S. cerevisiae)-like Gene [Source:MGI (curated);Acc:Supt7l-002]

 
Come back to gene ENSMUSG00000053134


For any suggestions or comments, please send an email to unitrap@crg.es