Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189778
Clone ID OST189778
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189778
Sequence
ACTGAGGTGGGGTCTTTCAGCTCCTGGCGCCGTTCGCCTCTGTCGTCGCTGCCACCAACGCCGCCGCCATTCTTGGCGCG
GAGCTGGCCTGGCCAGCCCCCGCCGAGAGCCTCCGCGGGTCGGACGCGCGCTCCAGATACTCCAACAAAAGCAACTTGAG
GGAGCTGGAGAGATGGCCTCAGCGATTGAGAGCACTGACTGTTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACA
TGGNGGCTCACAACCATCTGTAATGGGATCTGATGCCTTCTTCTGGNGTGTCTGAAGATAGCTACAGTATACTCATAAGT
AAAATAAATCTTTTTTTAGAAGGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25269

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51875562..51888983 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021451 (Sema4d) NM_013660 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D Gene [Source:MGI (curated);Acc:Sema4d-001]

 
Come back to gene ENSMUSG00000021451


For any suggestions or comments, please send an email to unitrap@crg.es