Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189467
Clone ID OST189467
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189467
Sequence
GACTGAGGACGGGGCGGTAACAACTCTTTCACTCATGAGGCTCTCACACTCAAGTATAAACTGGACAACCAGTTTGAGCT
GGTGTTTGTGGTTGGCTTTCAGAAGATCCTCACGCTGACCTATGTAGACAAGTTGATAGATGATGTGCACCCGACTGTTC
CGGGATAAGTATCGCACAGAGATCCAACAACAGAGTGCTTCAAGTCTATTGAATGGCACATTTGATTTCCAAAATGACTT
CCTGCGGCTCCTTCGTGAAGCAGAGGAGAGCAGTAAGATCCGTGCTCCCACTACCATGAAGAAATTTGAAGATTCTGAAA
AAGCTAAGAAACCTGTGAGGTCCATGATTGAAACACGGGGGGAAAAGACCAAGGAAAAAGC
Sequence Type mRNA
Unitrap ID UNI10077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 35019579..35020430 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032042 (Srpr) NM_026130 signal recognition particle receptor ('docking protein') Gene [Source:MGI (curated);Acc:Srpr-001]

 
Come back to gene ENSMUSG00000032042


For any suggestions or comments, please send an email to unitrap@crg.es