Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB010
Clone ID YHB010
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB010
Sequence
ATGGGAAGTCACTTCTGGAGTTAGCCAGAATGGAGAATGGAGTGTTGGGAAATGCCTTAGAAGGAGTGCATGTAGAAGAG
GAAGAAGGAGAAAAAACAGAAGATGAATCTTTGGTAGAAAATTAATGATAATGTAGAT
Sequence Type mRNA
Unitrap ID UNI5924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116284578..116286962 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es