Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189396
Clone ID OST189396
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189396
Sequence
GACTGAGTTTAATTGGTTGGGGCCAGNAAAGGAAGAGGCGTGACTATCAAGCCAACAATAGATGATGAATGAGATGATAC
ATTNGGATGAAACCAGGAATTTTTTCATAACAGTCTTAGAGATATTTTCAAATCTAAAAAGTAGGACATCTAAAGAAGGA
AATAAATTTCACAGCTTATTATTATATTAGTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 364629..364818 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069049 (Eif2s3y) NM_012011 eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked Gene [Source:MGI (curated);Acc:Eif2s3y-001]

 
Come back to gene ENSMUSG00000069049


For any suggestions or comments, please send an email to unitrap@crg.es