Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189337
Clone ID OST189337
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189337
Sequence
TACTGTGACCAGAGCAAGCAGCAGAAGGCCAGCCGCTACCTGGNAGCCCAGAAGGGAGCCTACCCAATCCTCCTGGCTGC
CTGGCAGCATGGCTGCCACTAGCAACCAGGGTCTTCTGCTCCAGGCTCTCAATGCTCTGGCAGTGCTGACTGATGGCCAG
CCTGACCTCCTGGATGCCCAGGGCTTGCATCTTCTCGTGGCCACGCCTAGCACAGAATGCCGCCAACACTGAACTCACGT
GCTGTGGGATTCGCTGCGTGCGCCATGTCTGCCTAAAGCACGAACAGAATCGGCAGGACTTGGTGAAAGCTGGCGTGTTG
CCCCTGCTCACAGCGGCTATTACACAGCATGGCCAGCACGCCGATGTGGTCAGGGAGGCCTGCTGGGCCTTGCGGGTCAT
GACCTTTGATGATGATATCCGAGTGCCCCTTTGGCCATTGCCCATGAGCACCCCAAGATGAT
Sequence Type mRNA
Unitrap ID UNI19677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72748846..72749301 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002343 (Armc6) NM_133972 armadillo repeat containing 6 Gene [Source:MGI (curated);Acc:Armc6-001]

 
Come back to gene ENSMUSG00000002343


For any suggestions or comments, please send an email to unitrap@crg.es