Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB033
Clone ID YHB033
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB033
Sequence
CTGGCCCTCTGCCCCGTTCACCATGCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTATTCATTGAATTTT
GTGTTGAAGACAGTAAAGATGTTAATGTAAACTTTGAAAAATCCAAACTTACTTTCAGTTGTCTTGGAGGAAGCGATAAT
TTTAAGCATTTAAATGAAATTGATCTTTTTCATTGTATCGATCCAAATGATTCCAAGCATAAAAGAACAGACAGATCGAT
TTTATGTTGTTTGCGAAAAGGAGAATCCGGCCAGTCATGGCCTAGGTTAACAAAGGAAAGGGCAAAGCTTAATTGGCTCA
GTGTGGACTTCAATAATTGGAAAGACTGGGAGGATGACTCAGATGAAGACATGTCGAATTTTGACCGTTTCTCTGAGATG
ATGGATCACATGGGTGGTGATGAGGATGTAGATTTACCAGAAGTAGATGGAGCAGATGATGATTCACAAGACAGTGATGA
TGAAA
Sequence Type mRNA
Unitrap ID UNI6621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127496319..127512418 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es