Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST189167
Clone ID OST189167
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST189167
Sequence
ACTGAGGGTAGAGTGACCCTATGATGATGTGCNTGTGAACTTCACTCGGGAAGCGTGGGCTTTGCTGGNNTCTTCTCAGA
AGANTCTCTACAAAGAAGTGATGCTGGAGACCTACAGGAATCTTCGCTGCTATAGGCTATGTTTGGGAAGACCATAATAC
GGAAGAGCATCTTCATATTTCTAGAAGATATGGAAGGCATGAAAGAAGTCATACTGAACAGCTGCTCTCTGAGTTTATCC
AATGTGATAAAGCCTTTGCATTTCAGAGTCATAACCAAAGACAAGAAAGAATTCATACTGCAGAGACACCCTATGAATGT
AACCAATGTGGTAAATCCTTTGCAAGAAAGAGTCATCTCCTAAGACATAAAAGAACACATACTGGAGAGAAACCCTTTCA
ATGTTACCAATGTGGTAAAACTCTTGCTCGAAATACTCATCTCCTACAACATAAAAAAGTACACACTGGAGAGAAACCCT
ATGAATGTAAGCATTGTGACAAAGCCTCTGTATGTCATATTGGNCTCCTGTATCATAAAAGAACACATGCTGGACAGAGA
CCATAT
Sequence Type mRNA
Unitrap ID UNI24322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150016127..150017961 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079009 (EG245174) predicted gene, EG245174 Gene [Source:MGI Symbol;Acc:MGI:3644476]

 
Come back to gene ENSMUSG00000079009


For any suggestions or comments, please send an email to unitrap@crg.es