Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188867
Clone ID OST188867
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188867
Sequence
ACTGACGGCCTCAGGAAGNTTAGGGCTGCGGCAGACGTATGTCGCATCNNTCTACGACATGACGGTNTCGGACNTGCTCC
CNCNCCGACGACCGCNNGANNGNGGGNGGGCCTGTCCCNNTCTGTCTCCGTGCAGACAAAAAGTGCNTANGTCGTTGAAG
ANGGCAAAGAGCGCTTGGTGGGAGCGGTTGGCAGCCACCATAACTGATCCTTTCAAGCATTTTGTCGGAATGCTTCCTGA
AAAAGATTGTCGCTATGCTTTGTATGACGCCAGCTTTGAGACCAAGGAGTCCAGGAAAGAAGAGCTGATGTTCTTCCTGT
GGGCACCAGAACAAGCACCTCTGAAAAGTAAAATGATCTATGCAAGCTCGAAGGATGCCATCAAGAAGAAATTTCCAGGT
ATAAAACATGAGTATCAAGCAAATGGGCCAGAAGACCTCAATCGGACCTGTATTGCTGAAAAGCTAGGTGGCTCCTTAAT
TGTAGCCTTTGAAGGATCCCCTGTGTAGACCGCCAGNCAGTGCCACGAGTTGAAAGCTTCCATACTGAACACTATCCTTT
Sequence Type mRNA
Unitrap ID UNI21271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143764120..143768024 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es