Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188737
Clone ID OST188737
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188737
Sequence
AGACTGAGGTGGGGTCTTTCAGCACTTCTCCGAGGAGGAGGACAGCGAGCGCAGCANCGAGGCGGAGGAGGCCGAGGTAT
CCCCAGATNTTCCANAAGTGTGTATGTATTGCCTACTGNGTGCCANCCTGTACAAGTCTTTGTCCTTGGGCTCCTGCTAA
CAGATTTTAAAATGTAAATCGACAACTGATGGGTGAATGTGAATTTGCTACTGTGAATAAATATAGCCAGTAAATATGAG
AGA
Sequence Type mRNA
Unitrap ID UNI2539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29122876..29123428 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

 
Come back to gene ENSMUSG00000003435


For any suggestions or comments, please send an email to unitrap@crg.es