Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHB395
Clone ID YHB395
Vector pGT0Lxf
Project baygenomics

Sequence tag YHB395
Sequence
CTCCTGCGGCGTTGGTGGCGAGCTAAGGTGGAGGCAAGCAGCGGCGGCGACGGCGACAGTGGCGGCAGTGCCATGGTGGG
GCTCG
Sequence Type mRNA
Unitrap ID UNI5024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157391987..157392071 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067787 (Blcap) NM_016916 bladder cancer associated protein homolog (human) Gene [Source:MGI (curated);Acc:Blcap-002]

 
Come back to gene ENSMUSG00000067787


For any suggestions or comments, please send an email to unitrap@crg.es