Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188299
Clone ID OST188299
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188299
Sequence
AACTGAGGAACCTAGTAACAAAAGGGTCAAACCCCTTTCCAGAGTCACATCGCTAGCAAACCTCATTCCACCTGTGAAGA
CCACACCATTAAAGCGCTTCAGCCAGACCTTGCAGCGGTCCATCAGCTTCCGCAGCGAGAGCCGCCCCGACATCCTTGCC
CCCCGAGCTTGGTCCAGAAATGCCACCTCCTCAAGCACAAAGCGGAGAGACAGCAAACTGTGGAGTGAGACCTTCGATGT
GTGTGTCAATCAGGTGCTCACGGCCAAGGAGATCAAGAGACAGGAGGCGATCTTTGAACTTTCTCAAGGTGAAGAAGACT
TGATAGAGGACTTGAAATTAGCAAAAAAGGCCTACCACGACCCCATGCTGAAACTCTCCATAATGACGGAACAGGAACTG
AATCAGATTTTTGGGACCCTGGACTCTCTAATTCCTCTCCATGAAGAGCTCCTCAGTCANCTTCGANATGTTTCGGAAAC
CCGATGGCTC
Sequence Type mRNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28175974..28199321 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es