Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188238
Clone ID OST188238
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188238
Sequence
ACAGTGGTTCCTCTCNTGTNTCAAGTTCNTCAGCCTCCAGCAACCTCAGCCACCTGGAGGAAGACTCTTGGNTTCTCTGG
GGAAGAATTGTGAATGAATGGGATGATGTACTGCAAGAAGAAAGAAAAGCAAGTGAAGGAGCNTTGTTCGTAAAGGGATA
CCCCATCACTTCAGAGCAATAGTGTGGCAACTTTTATGTAATGCACAGAGTATGACAATTAAGGACCAGTATTCAGAACT
CCTGAAAATGACTTCACCTTGTGAAAAACTGATACGAAGGGACATTGCTAGAACTTATCCAGAACACAACTTTTTTAAGG
AAAAAGATAGCCTTGGACAGGAGGTTTTATTTAATGTAATGAAGGCATACTCCTTAGTGGACCGTGAGGTTGGTTACTGT
CAGGGCAGTGCTTTCATCGTTGGATTGTTGCTGATGCAGATGCCAGAAGAAGAGGCTTTTTGTGTATTTGTTAAATTAAT
GCAAGACTACAGACTTCGTGAACTATTTAAGCCAAGTATGGCGGG
Sequence Type mRNA
Unitrap ID UNI19190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108247949..108250860 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es