Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188116
Clone ID OST188116
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188116
Sequence
GACTGAGATGACAGTCATGTCCCTCTCCAGGGNCCTCAAGGACGACTTTCACAGTGACACAGTACTCTCCATCTTAAATG
AGCAGCGCATTCGGGGCATCTTATGTGATGTCACCATCATCGTGGAAGACACCAAGTTTAAAGCCCACAGCAATGTCCTG
GCCGCCTCAAGTCTTTATTTCAAAAACATCTTTTGGAGCCATACGATCTGCATTTCCAGNCACGTCTTGGAGCTGGATGA
TCTGAAAGCCGAAGTGTTTACAGAAATACTTAATTATATCTACAGCTCTACCGTTGTGGTCAAAAGACAGGAAACCGTCA
CTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCATTCTTAGAAGACCTTAGTGACCGCAACTTCTCAAATTCCCCA
GGTCCTTACGTAGTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96589004..96589450 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es