Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST188040
Clone ID OST188040
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST188040
Sequence
CAGTGAAATAACCAAGGCACAGNNGACTTTCTCCCCAACCGGCCACTGCCACACCTGGGAGTGGCATAGCTGTCACCAAC
ATTACCACAGCATGGACGAGTTCAGCCACTACGACCTGCTTGATGCATCCACGGGCAAGAAGGTAGCCGAGGGACACAAG
GCCAGCTTCTGCCTGGAGGACAGCACCTGTGACTTCGGCAACCTCAAGCGCTATGCCTGCACCTCTCACACGCAGGGCCT
GAGTCCAGGCTGCTATGACACATACAATGCGGACATTGACTGCCAGTGGATCGACATAACTGATGTGCAGCCTGGGAACT
ACATCCTCAAGGTGCACGTGAACCCCAAGTACATTGTTCTGG
Sequence Type mRNA
Unitrap ID UNI25311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58138647..58142240 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es