Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA303
Clone ID RHA303
Vector pGT0Lxf
Project baygenomics

Sequence tag RHA303
Sequence
TTGAAGAATATGTAGAAGAGGATGTTTTTTTTTTAAGAAAGAGTATCCAGATCAAAGCCGCGTCCCGGATGTCC
Sequence Type mRNA
Unitrap ID UNI6650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 34113289..34118632 27
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021408 (Ripk1) NM_009068 receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]

 
Come back to gene ENSMUSG00000021408


For any suggestions or comments, please send an email to unitrap@crg.es