Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST187687
Clone ID OST187687
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST187687
Sequence
GACTGAGGAGTCTGTATCTTTTGAGGATGTGGCTGTGACTTCACTGCGGAGGAGTGGGCTTTGCTGANTTCTTCCCAAAA
GAGGCTACACAGAGNTGTGATGCAGGAAACCTTCAGGAATTTGGCCTGCCCTAGGTAAGGGTAAGATCACTGCCTTGTTT
AGTCCATGAGAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74437019..74437194 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052439 (OTTMUSG00000022410) predicted gene, OTTMUSG00000022410 Gene [Source:MGI Symbol;Acc:MGI:3642748]

 
Come back to gene ENSMUSG00000052439


For any suggestions or comments, please send an email to unitrap@crg.es